Advertisement

Association of two Lysyl oxidase (LOX) Gene single nucleotide polymorphism with Keratoconus; a nationwide registration study

Open AccessPublished:November 09, 2022DOI:https://doi.org/10.1016/j.xops.2022.100247

      Abstract

      Purpose

      Keratoconus (KC) is the most common primary ectatic corneal disease, characterized by progressive thinning of the cornea, affecting its shape and structure and leading to visual loss. Lysyl oxidase (LOX) is an important component of the extracellular matrix (ECM) and contributes to the homeostasis of corneal stromal ECM via enzymatic reaction. This nationwide registration study aims to examine the association of KC with two known single nucleotide polymorphisms (SNPs), rs2956540 and rs10519694, in a population of Iranian descent.

      Design

      Case-control

      Participants

      One hundred seventy-eight subjects with KC and one hundred eighty clinically healthy subjects participated in the study.

      Methods

      Genomic DNA was extracted from peripheral blood samples, and their genotypes were determined using tetra-primer amplification-refractory mutation system-polymerase chain reaction (T-ARMS PCR).

      Main outcome measured

      Allele frequency for rs2956540 and rs10519694

      Results

      Genotypic frequency was significantly different between cases and controls for rs2956540 (p-value = 0.019). The rs2956540 C allele carriers were significantly more frequent among KC cases than healthy controls (p-value chi-square = 0.015, p-value Fisher's Exact = 0.010). There was a significant difference in genotype frequency between groups for rs10519694 (p-value = 0.001). T allele carriers were significantly more frequent among KC patients (p-value chi-square = 0.002, p-value Fisher's Exact = 0.001). Sex stratification revealed no significant differences in genotype frequency between males and females in cases and controls. Fitting the general linear model (GLM) showed that rs10519694 could be considered a predictor for developing of KC (p-value = 0.001); however, this was not observed for rs2956540 (p-value = 0.323) .

      Conclusions

      rs2956540 and rs10519694 are associated with KC in a population of Iranian descent. rs10519694 could potentially be used for KC risk prediction.

      Keywords

      Abbreviations and Acronyms:

      C (Cytosine), ECM (Extracellular matrix), G (Guanine), GWAS (Genome-Wide Association Study), GLM (General Linear Model), FN1 (Glycoprotein fibronectin), HWE (Hardy-Weinberg equilibrium), KC (Keratoconus), LOX (Lysyl oxidase), MMP9 (Metalloproteinase 9), T (Thymine), T-ARMS PCR (Tetra-primer amplification-refractory mutation system-polymerase chain reaction), TIMP1, TIMP2 (Tissue inhibitor of metalloproteinase 1 and 2), THBS1 (Thrombospondin1), TGFBI (Transforming growth factor beta-induced gene), SNPs (Single nucleotide polymorphisms)
      Keratoconus (KC), or conical cornea, is characterized by bilateral, progressive, non-inflammatory thinning and protrusion of the cornea, which usually leads to visual impairment from myopia and irregular astigmatism
      • Davidson A.
      • Hayes S.
      • Hardcastle A.
      • Tuft S.
      The pathogenesis of keratoconus.
      . KC is the most common corneal ectatic disorder
      • Gordon-Shaag A.
      • Millodot M.
      • Shneor E.
      • Liu Y.
      The genetic and environmental factors for keratoconus.
      and one of the most common reasons for corneal transplantation, especially in younger patients
      • Buzard K.A.
      • Fundingsland B.R.
      Corneal transplant for keratoconus: Results in early and late disease.
      • Özalp O.
      • Atalay E.
      • Yıldırım N.
      Prevalence and risk factors for keratoconus in a university-based population in Turkey.
      • Netto E.A.T.
      • Al-Otaibi W.M.
      • Hafezi N.L.
      • et al.
      Prevalence of keratoconus in paediatric patients in Riyadh, Saudi Arabia.
      . Its estimated prevalence is 0.17 to 47.90 per 1000 in different populations
      • Godefrooij D.A.
      • De Wit G.A.
      • Uiterwaal C.S.
      • Imhof S.M.
      • Wisse R.P.L.
      Age-specific incidence and prevalence of keratoconus: a nationwide registration study.
      • Omer K.
      Epidemiology of keratoconus worldwide.
      • Xu X.
      • Zhang X.
      • Cui Y.
      • et al.
      Three novel variants identified within ECM-related genes in Chinese Han keratoconus patients.
      . Both genders are equally affected, and the disease is more prevalent among Asians than Caucasians
      • Xu X.
      • Zhang X.
      • Cui Y.
      • et al.
      Three novel variants identified within ECM-related genes in Chinese Han keratoconus patients.
      ,
      • Hashemi H.
      • Heydarian S.
      • Hooshmand E.
      • et al.
      The Prevalence and Risk Factors for Keratoconus: A Systematic Review and Meta-Analysis.
      .
      KC is a multifactorial disease with a single etiology remaining unknown. Family-based and twin studies have demonstrated both genetic and environmental factors impact pathogenesis
      • Khawaja A.P.
      • Rojas Lopez K.E.
      • Hardcastle A.J.
      • et al.
      Genetic Variants Associated With Corneal Biomechanical Properties and Potentially Conferring Susceptibility to Keratoconus in a Genome-Wide Association Study.
      • Guerra G.
      • de Oliveira V.
      • Ferreira I.
      • Ramos I.
      • Belin M.
      • Ambrósio Jr., R.
      Subclinical keratoconus detection in identical twins.
      • Bykhovskaya Y.
      • Rabinowitz Y.S.
      Update on the genetics of keratoconus.
      .
      Histochemical analysis shows disturbances in the homeostasis of the extracellular matrix (ECM) of the keratoconic cornea

      Khaled ML, Helwa I, Drewry M, Seremwe M, Estes A, Liu Y. Molecular and Histopathological Changes Associated with Keratoconus. BioMed Research International. 2017/01/30 2017;2017:7803029. doi:10.1155/2017/7803029

      ,
      • Dudakova L.
      • Liskova P.
      • Trojek T.
      • Palos M.
      • Kalasova S.
      • Jirsova K.
      Changes in lysyl oxidase (LOX) distribution and its decreased activity in keratoconus corneas.
      . Lysyl oxidase (LOX)
      • Bykhovskaya Y.
      • Li X.
      • Epifantseva I.
      • et al.
      Variation in the lysyl oxidase (LOX) gene is associated with keratoconus in family-based and case-control studies.
      , metalloproteinase 9 (MMP9)
      • Bykhovskaya Y.
      • Gromova A.
      • Makarenkova H.P.
      • Rabinowitz Y.S.
      Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus.
      ,
      • Collier S.A.
      Is the corneal degradation in keratoconus caused by matrix‐metalloproteinases?.
      , tissue inhibitor of metalloproteinase 1 and 2 (TIMP1, TIMP2)
      • Bykhovskaya Y.
      • Gromova A.
      • Makarenkova H.P.
      • Rabinowitz Y.S.
      Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus.
      ,
      • Collier S.A.
      Is the corneal degradation in keratoconus caused by matrix‐metalloproteinases?.
      , transforming growth factor beta-induced gene (TGFBI)
      • Bykhovskaya Y.
      • Gromova A.
      • Makarenkova H.P.
      • Rabinowitz Y.S.
      Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus.
      ,
      • Rabinowitz Y.S.
      • Dong L.
      • Wistow G.
      Gene expression profile studies of human keratoconus cornea for NEIBank: a novel cornea-expressed gene and the absence of transcripts for aquaporin 5.
      ,
      • Tai T.Y.T.
      • Damani M.R.
      • Vo R.
      • et al.
      Keratoconus associated with corneal stromal amyloid deposition containing TGFBIp.
      , glycoprotein fibronectin (FN1)
      • Bykhovskaya Y.
      • Gromova A.
      • Makarenkova H.P.
      • Rabinowitz Y.S.
      Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus.
      , integrin
      • Bykhovskaya Y.
      • Gromova A.
      • Makarenkova H.P.
      • Rabinowitz Y.S.
      Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus.
      , and thrombospondin1 (THBS1)
      • Bykhovskaya Y.
      • Gromova A.
      • Makarenkova H.P.
      • Rabinowitz Y.S.
      Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus.
      ,
      • Macé M.
      • Galiacy S.D.
      • Erraud A.
      • et al.
      Comparative transcriptome and network biology analyses demonstrate antiproliferative and hyperapoptotic phenotypes in human keratoconus corneas.
      are some examples of ECM-related genes involved in the development of KC.
      Lysyl oxidase is a copper-dependent enzyme encoded by the LOX gene (Location: 5q23.2) that plays an important role in maintaining the ECM by forming elastin and collagen cross-links using oxidative deamination catalysis of lysine and hydroxylysine residues
      • Hasanian-Langroudi F.
      • Saravani R.
      • Validad M.-H.
      • Bahari G.
      • Yari D.
      Association of Lysyl oxidase (LOX) polymorphisms with the risk of Keratoconus in an Iranian population.
      . Connections between LOX chromosomal location in familial KC and altered LOX activity in individuals with KC support a promising role of LOX in the incidence of KC
      • Shetty R.
      • Sathyanarayanamoorthy A.
      • Ramachandra R.A.
      • et al.
      Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity.
      • Bykhovskaya Y.
      • Margines B.
      • Rabinowitz Y.S.
      Genetics in Keratoconus: where are we?.
      • Li X.
      • Rabinowitz Y.S.
      • Tang Y.G.
      • et al.
      Two-stage genome-wide linkage scan in keratoconus sib pair families.
      . A case-control Genome-Wide Association Study (GWAS) in American Caucasians revealed the association of KC with single nucleotide polymorphisms (SNPs) lies within LOX
      • Bykhovskaya Y.
      • Li X.
      • Epifantseva I.
      • et al.
      Variation in the lysyl oxidase (LOX) gene is associated with keratoconus in family-based and case-control studies.
      .
      Several studies have already highlighted the role of LOX variants, especially SNPs, in the risk of KC
      • Bykhovskaya Y.
      • Li X.
      • Epifantseva I.
      • et al.
      Variation in the lysyl oxidase (LOX) gene is associated with keratoconus in family-based and case-control studies.
      ,
      • Bykhovskaya Y.
      • Margines B.
      • Rabinowitz Y.S.
      Genetics in Keratoconus: where are we?.
      ,
      • Liskova P.
      • Dudakova L.
      • Krepelova A.
      • Klema J.
      • Hysi P.G.
      Replication of SNP associations with keratoconus in a Czech cohort.
      • Ates K.M.
      • Estes A.J.
      • Liu Y.
      Potential underlying genetic associations between keratoconus and diabetes mellitus.
      • Abu-Amero K.K.
      • Helwa I.
      • Al-Muammar A.
      • et al.
      Case-control association between CCT-associated variants and keratoconus in a Saudi Arabian population.
      . A study in an Iranian population demonstrated that rs1800449 is significantly associated with KC and increasing KC risk, whereas a similar effect was not observed in rs2288393
      • Hasanian-Langroudi F.
      • Saravani R.
      • Validad M.-H.
      • Bahari G.
      • Yari D.
      Association of Lysyl oxidase (LOX) polymorphisms with the risk of Keratoconus in an Iranian population.
      . Another study revealed that both rs1800449 and rs2956540 are significantly associated with KC
      • Bykhovskaya Y.
      • Li X.
      • Epifantseva I.
      • et al.
      Variation in the lysyl oxidase (LOX) gene is associated with keratoconus in family-based and case-control studies.
      , as did a separate study of European descendants examining rs2956540 and rs3735520
      • Dudakova L.
      • Palos M.
      • Jirsova K.
      • et al.
      Validation of rs2956540:G>C and rs3735520:G>A association with keratoconus in a population of European descent.
      .
      Among all SNP variants located in LOX, rs2956540 and rs10519694 are two intronic variants located in the fourth intron of LOX. Accordingly to the Genotype-Tissue Expression (GTEx) database (https://gtexportal.org/home/), rs2956540 and rs10519694 have been known as expression quantitative trait loci (eQTLs) in several tissues. Therefore, it is possible that rs2956540 and rs10519694 might be eQTLs in corneal tissue too, and alter the risk of KC. Also SNP rs2956540 may affect gene expression through transcriptional regulation, as predicted by Genomatrix (http://www.genomatix.de/) that it can alter the binding sites of several transcription factors like PTX1, CMYB, and ISM1
      • Zhang J.
      • Zhang L.
      • Hong J.
      • Wu D.
      • Xu J.
      Association of common variants in LOX with keratoconus: a meta-analysis.
      .
      Few studies have evaluated the association of these two variants with KC among different populations
      • Zhang J.
      • Zhang L.
      • Hong J.
      • Wu D.
      • Xu J.
      Association of common variants in LOX with keratoconus: a meta-analysis.
      . The latest meta-analysis in 2015 showed that rs2956540 and rs10519694 variants have a significant association with KC, whereas it failed to replicate this result in rs1800449 and rs2288393
      • Zhang J.
      • Zhang L.
      • Hong J.
      • Wu D.
      • Xu J.
      Association of common variants in LOX with keratoconus: a meta-analysis.
      . This study explores the association of rs10519694 and rs2956540 with KC in a population of Iranian descent.

      Methods

      The study was performed in Negah Eye Hospital, Tehran, Iran between January 2020 and January 2022. It was approved by the institutional review board and ethics committee of the Ophthalmic Research Center, Research Institute for Ophthalmology and Vision Science, Shahid Beheshti University of Medical Sciences, Tehran, Iran (IR.SBMU.ORC.REC.1399.015) and met the Helsinki Declaration criteria. KC was primarily diagnosed based on clinical criteria including Vogt’s striae, Fleischer’s ring, corneal stromal thinning and protrusion, and video-keratography findings
      • Rabinowitz Y.S.
      • Matalia H.
      • Swarup R.
      Imaging modalities in keratoconus.
      • Kriszt Á.
      • Losonczy G.
      • Berta A.
      • Takács L.
      Presence of Fleischer ring and prominent corneal nerves in keratoconus relatives and normal controls.
      . The Pentacam HR (Oculus, Wetzlar, Germany) and the Corvis ST (OCULUS Optikgeräte GmbH; Wetzlar, Germany) were done for all suspicious cases to detect mild forms of KC (Tables 1 and 2)
      • Ambrósio R.
      • Lopes B.T.
      • Faria-Correia F.
      • et al.
      Integration of Scheimpflug-Based Corneal Tomography and Biomechanical Assessments for Enhancing Ectasia Detection.

      Mohammadpour M. Diagnostics in Ocular Imaging: Cornea, Retina, Glaucoma and Orbit. Springer Nature; 2020.

      • Augustin V.A.
      • Son H.-S.
      • Baur I.
      • Zhao L.
      • Auffarth G.U.
      • Khoramnia R.
      Detecting subclinical keratoconus by biomechanical analysis in tomographically regular keratoconus fellow eyes.
      • Kataria P.
      • Padmanabhan P.
      • Gopalakrishnan A.
      • Padmanaban V.
      • Mahadik S.
      • Ambrósio R.
      Accuracy of Scheimpflug-derived corneal biomechanical and tomographic indices for detecting subclinical and mild keratectasia in a South Asian population.
      . All diagnoses were approved by two cornea specialists (FD, AB). Complete medical histories were obtained from all patients with KC. No other ocular disorders or risk factors (including contact lens use, eye rubbing, atopy, etc.) or systematic diseases (including connective tissue disorders) were uncovered. All healthy controls had no personal or familial history of eye-related, metabolic, or immune system-related disease. All participants or their legal guardians signed consent forms.
      Table 1Pentacam criteria for risk of keratectasia
      CriteriaNormalSuspectAbnormal
      Pentacam
      K max (D)<47.247.2-49>49
      Against the rule astigmatism (D)<11-2>2
      Corneal astigmatism (D)<66-7>7
      Thinnest point (μm)>500470-500<470
      Difference between pachy apex and thinnest location (μm)<1010-20>20
      Difference in central thickness between two eyes (μm)<1010-30>30
      Displacement of the thinnest point from the center (mm)<0.50.5-1>1
      Skewed Steepest Radial Axis (SRAX) (degrees)<1010-20>21
      IS value (Inferior-Superior difference at the 3 mm) (D)<1.41.4-1.9>1.9
      IS value (Inferior-Superior difference at the 5 mm) (D)<1.41.4-2.5>2.5
      Anterior elevation (μm)<1010-12>12
      Posterior elevation (μm)<1515-17>17
      Table 2The Clinically Suggested Cut-off Values for Keratoconus Indices in Screening Clinical and Subclinical Cases
      ParameterClinical KeratoconusSubclinical Keratoconus
      Tomographic
      CKI****
      KI1.07**
      IHA10.4**
      IHD0.017**
      TKC1.02.0
      ISV36.6**
      IVA0.280.15
      Rmin7.04**
      PE20.510.5
      IS value1.11.9
      KISA60%100%
      Pachymetric
      ART-Min606**
      ART-Max356368
      ART-Avg444490
      BAD_D2.021.31
      CCT515518
      PPI-Min0.870.80
      PPI-Max1.531.40
      PPI-Avg1.181.08
      TCT506502
      CKI: central keratoconus index, KI: keratoconus index, IHA: index of height asymmetry, TKC: topographic keratoconus classification, ISV: index surface variance, IVA: index of vertical asymmetry, IHD: index of highest decentration, Rmin: minimum radius of curvature, PE: prediction error, IS value: the Inferior-Superior value, ART: Ambrosio's relational thickness indices, BAD_D: Belin/Ambrósio deviation, CCT: central corneal thickness, PPI: pachymetric progression indices, TCT: thinnest corneal thickness, KISA: The KISA index was derived from the following 4 indices: central K; I–S; the SRAX index, an expression of irregular astigmatism occurring in keratoconus; and the astigmatism index (AST), which quantifies the degree of the regular corneal astigmatism (simulated K1 − simulated K2)

      Genotyping

      Five ml of peripheral blood was collected from all participants and stored in an EDTA tube at -20 °C until DNA was extracted. Total genomic DNA was extracted using a salting-out protocol
      • Chacon Cortes D.F.
      • Griffiths L.
      Methods for extracting genomic DNA from whole blood samples: current perspectives.
      . Agarose 1% gel electrophoresis and UV-spectroscopy were used to assess the quality and quantity of extracted DNA, respectively. rs2956540 and rs10519694 were genotyped using tetra-primer amplification-refractory mutation system-polymerase chain reaction (T-ARMS PCR). 3’allele-specific primers designed by primer1 online tool (http://primer1.soton.ac.uk/primer1.html) were used for amplification. The T-ARMS PCR was carried out in 20 μl mixtures containing 100 ng of genomic DNA, 10 μl of Taq DNA Pol 2X Master Mix Red (Amplicon, Denmark), 0.5 μl of two outer primers, 1 μl of two inner primers for each SNP, and the remainder came from double-distilled water. PCR reactions were performed using the Eppendorf thermocyclers (Eppendorf AG 22331 OMIM 148300) under the following conditions: 94 °C for 4 min, followed by 35 cycles including denaturing at 94 °C for 30 s, annealing for 30 s at 60 °C and 62 °C for rs2956540 and rs10519694, respectively, and extension at 72 °C for 30 s. A final extension was conducted at 72 °C for 5 min. Finally, the PCR product ran on 2% gel electrophoresis. Based on the sizes of the PCR products on the gel electrophoresis, the genotypes were determined (Table 3).
      Table 3T-ARMS-PCR primer sequences, Melting temperatures (Tm) and the size of PCR product for every genotype.
      SNPPrimer sequencePCR productGenotype (bp)
      rs2956540Forward inner primer (C allele):

      ACTTATTTTTCCTCCATTTGCTAAGCC
      209CC (417, 209)
      Reverse inner primer (G allele):

      GTTTTATGCTGAAAATAGAATAGTGGTAGC
      265GG (417, 265)
      Forward outer primer (5' - 3'):

      CTGACATAGATTTTAACTGACACGCATT
      417CG (417, 265, 209)
      Reverse outer primer (5' - 3'):

      CAGTCCACAATGAAGAACAAAAATTTAC
      rs10519694Forward inner primer (C allele):

      AAATATTCACATCAATAAGTAAATGAAGGC
      252CC (402, 252)
      Reverse inner primer (T allele):

      TATTTTTCTCCTCCCAGCCTGTAGACGA
      208TT (402, 208)
      Forward outer primer (5' - 3'):

      TGGTTTTGAGTTTAGGTAATCAAGGTCC
      402CT (402, 252, 208)
      Reverse outer primer (5' - 3'):

      TGCTAGAATTGAATGGCAGTATTGAGTT
      SNP: single nucleotide polymorphisms, PCR: polymerase chain reaction, T-ARMS: tetra-primer amplification-refractory mutation system

      Statistical analysis

      All statistical analyses were performed using SPSS Statistics for Windows, version 22.0 (SPSS Inc., Chicago, IL, USA). Two-tailed Mann-Whitney and Pearson Chi-Square tests were used to compare age and gender. Pearson Chi-Square test was used to compare allele and genotype frequency between cases and controls and to assess divergence from Hardy-Weinberg equilibrium (HWE). The allele risk was evaluated using two-tailed Fisher's Exact Test and Odds Ratio (OR) with a 95% confidence interval. Logistic regression was used to fit the general linear model (GLM) to the data to predict KC risk using rs2956540 and rs10519694. Statistical significance was defined as a P value of 0.05.

      Results

      Demographic data

      A total of 358 unrelated individuals (178 KC and 180 healthy controls) were enrolled in the study. Mean age of KC patients (92 males and 86 females) and healthy controls (97 males and 83 females) were 31.97 ± 9.37 years and 32.71 ± 6.88 years, respectively (p-value = 0.33). Gender was matched in both groups (p = 0.75) (Supplementary Table S4).

      Hardy-Weinberg equilibrium (HWE)

      In association studies, we typically hypothesize that healthy controls remain in HWE, whereas the subject groups deviate from HWE. This means one of the frequencies of the genotypes is higher or lower than what would be expected from mutation, natural selection, etc. Thus, in both rs2956540 and rs10519694, KC subjects departed from HWE (rs2956540: p-value = 0.038 / rs10519694: p-value = 0.048), whereas healthy controls remained in HWE (rs2956540: p-value = 0.93 / rs10519694: p-value = 0.090) (Supplementary Table S5).

      Allele frequency

      To calculate the frequency of each allele, the homozygotes of that allele were multiplied by two and added to the heterozygotes, and the result was divided by twice the population of the group. In this set of data, both rs2956540 and rs10519694 risk alleles showed higher frequencies compared to those displayed in the dbSNP database (rs2956540 C allele = 0.3, rs10519694 T allele = 0.2). Allele frequency did not significantly differ for rs2956540 (p-value = 0.2654) and rs10519694 (p-value = 0.08263) between cases and controls (Table 6).
      Table 6rs2956540 and rs10519694 allele frequency
      rs2956540rs10519694
      CGCT
      Case174 (48%)182 (52%)210 (58%)146 (42%)
      Control160 (44%)200 (56%)236 (65%)124 (35%)
      Pearson Chi-Square1.24023.0124
      df11
      p-value0.26540.0826
      C: Cytosine, G: Guanine, T: Thymine

      Genotype frequency

      To calculate the genotypic frequency in each group, the total number of each genotype was divided by the total population of that group. Genotypic frequency was significantly different between cases and controls for rs2956540 (p-value = 0.019). rs2956540 C allele carriers (CC & CG) were significantly more frequent among KC cases than healthy controls (p-value chi-square = 0.015, p-value Fisher's Exact = 0.010). There was a significant difference in genotype frequency between groups for rs10519694 (p-value = 0.001). T allele carriers were significantly more frequent among KC patients (p-value chi-square = 0.002, p-value Fisher's Exact = 0.001) (Tables 7 and 8). Sex stratification revealed no significant differences in genotype frequency between males and females in cases and controls (Table 9). Fitting the general linear model (GLM) showed that rs10519694 could be considered a predictor for developing of KC (p-value = 0.001); however, this was not observed for rs2956540 (p-value = 0.323) (Table 10).
      Table 7rs2956540 and rs10519694 genotype frequency
      rs2956540rs10519694
      CCCGGGCCTCTT
      Case34106385410222
      Control398259846828
      Pearson Chi-Square7.9414.03
      df22
      p-value Chi-square0.0190.001
      C: Cytosine, G: Guanine, T: Thymine
      Table 8Comparison of C allele carriers of rs2956540 and T allele carriers of rs10519694 between cases and controls
      rs2956540rs10519694
      CC + CGGGCCTT + TC
      Case1403854124
      Control121598496
      Pearson Chi-square5.9110.08
      df11
      p-value Chi-square0.0170.002
      p-value Fisher’s exact0.0170.002
      OR (CI = 0.95)1.792.01
      C: Cytosine, G: Guanine, T: Thymine, OR: odd ratio
      Table 9Gender-specific genotypic stratification
      rs2956540rs10519694
      CCCGGGCCTCTT
      CaseFemale175316224915
      Male17532232537
      Pearson Chi-square0.7464.721
      df22
      P-value0.6890.094
      ControlFemale193727423110
      Male204532423718
      Pearson Chi-square0.1421.737
      df22
      P-value0.9320.420
      C: Cytosine, G: Guanine, T: Thymine
      Table 10Fitting logistic regression model to genotype data
      BetaStandard Errorp-valueOR
      rs2956540-0.2650.2690.3230.767
      rs10519694-0.7250.2230.0010.484
      Intercept0.6700.2900.0211.954

      Discussion

      KC is a complex, multifactorial, genetic condition that can manifest in isolation or in association with other systemic genetic disorders. Bilaterality, familial aggregation
      • Karimian F.
      • Aramesh S.
      • Rabei H.M.
      • Javadi M.A.
      • Rafati N.
      Topographic evaluation of relatives of patients with keratoconus.
      • Kaya V.
      • Utine C.A.
      • Altunsoy M.
      • Oral D.
      • Yilmaz O.F.
      Evaluation of corneal topography with Orbscan II in first-degree relatives of patients with keratoconus.
      • Zadnik K.
      • Barr J.T.
      • Edrington T.B.
      • et al.
      Baseline findings in the Collaborative Longitudinal Evaluation of Keratoconus (CLEK) Study.
      , concordant monozygotic twins
      • Bechara S.J.
      • Waring 3rd, G.
      • Insler M.S.
      Keratoconus in two pairs of identical twins.
      , correlation with inflammatory bowel disease, Down syndrome
      • Cullen J.
      • Butler H.
      Mongolism (Down's syndrome) and keratoconus.
      , Leber congenital amaurosis

      Elder MJ. Leber congenital amaurosis and its association with keratoconus and keratoglobus. SLACK Incorporated Thorofare, NJ; 1994. p. 38-40.

      , diabetes mellitus
      • Ates K.M.
      • Estes A.J.
      • Liu Y.
      Potential underlying genetic associations between keratoconus and diabetes mellitus.
      , and ethnic
      • Hardcastle A.J.
      • Liskova P.
      • Bykhovskaya Y.
      • et al.
      A multi-ethnic genome-wide association study implicates collagen matrix integrity and cell differentiation pathways in keratoconus.
      differences in prevalence and incidence
      • Georgiou T.
      • Funnell C.
      • Cassels-Brown A.
      • O'conor R.
      Influence of ethnic origin on the incidence of keratoconus and associated atopic disease in Asians and white patients.
      all point to a genetic cause. Genetic relationships in KC will facilitate discovering biomarkers for early detection and monitoring progression. 14% of KC patients have a family history
      • Zadnik K.
      • Barr J.T.
      • Edrington T.B.
      • et al.
      Baseline findings in the Collaborative Longitudinal Evaluation of Keratoconus (CLEK) Study.
      . It remains uncertain how familial and sporadic KC differ genetically. Since family history does not alter genetic severity, genetic research can pool all cases
      • Rong S.S.
      • Ma S.T.U.
      • Yu X.T.
      • et al.
      Genetic associations for keratoconus: a systematic review and meta-analysis.
      . Numerous studies have investigated associations between isolated KC and genetic factors
      • Gordon-Shaag A.
      • Millodot M.
      • Shneor E.
      • Liu Y.
      The genetic and environmental factors for keratoconus.
      ,
      • Rong S.S.
      • Ma S.T.U.
      • Yu X.T.
      • et al.
      Genetic associations for keratoconus: a systematic review and meta-analysis.
      • Wang Y.
      • Rabinowitz Y.
      • Rotter J.
      • Yang H.
      Genetic epidemiological study of keratoconus: evidence for major gene determination.

      Kalra N, Sinha R. Genetics of Keratoconus. In: Nema HV, Nema N, eds. Genetics of Ocular Diseases. Springer Nature Singapore; 2022:15-23.

      • Hutchings H.
      • Ginisty H.
      • Le Gallo M.
      • et al.
      Identification of a new locus for isolated familial keratoconus at 2p24.
      . Several have suggested LOX to be one of the most promising genes associated with KC
      • Bykhovskaya Y.
      • Margines B.
      • Rabinowitz Y.S.
      Genetics in Keratoconus: where are we?.
      . Using an oxidative deamination catalytic reaction, LOX affects ECM homeostasis and maintenance in collagen and elastin-rich tissues, such as the cornea
      • Cai L.
      • Xiong X.
      • Kong X.
      • Xie J.
      The Role of the Lysyl Oxidases in Tissue Repair and Remodeling: A Concise Review.
      .
      Thus far, numerous studies have examined the association of KC with a wide spectrum of LOX single nucleotide variants. Thr392Pro and Pro32Leu substitutions are examples of exonic, non-synonymous point mutations observed in two Brazilian and Chinese KC patients
      • Xu X.
      • Zhang X.
      • Cui Y.
      • et al.
      Three novel variants identified within ECM-related genes in Chinese Han keratoconus patients.
      ,
      • Gadelha D.N.B.
      • Feitosa A.F.B.
      • da Silva R.G.
      • et al.
      Screening for novel LOX and SOD1 variants in keratoconus patients from Brazil.
      , whereas –116C > T and –58C > T are two LOX 5’UTR mutations that have been observed in two advanced KC patients
      • Gadelha D.N.B.
      • Feitosa A.F.B.
      • da Silva R.G.
      • et al.
      Screening for novel LOX and SOD1 variants in keratoconus patients from Brazil.
      . rs1800449 and rs2288393 are two well-known intergenic SNPs whose relationships to KC have been studied extensively
      • Bykhovskaya Y.
      • Li X.
      • Epifantseva I.
      • et al.
      Variation in the lysyl oxidase (LOX) gene is associated with keratoconus in family-based and case-control studies.
      ,
      • Hasanian-Langroudi F.
      • Saravani R.
      • Validad M.-H.
      • Bahari G.
      • Yari D.
      Association of Lysyl oxidase (LOX) polymorphisms with the risk of Keratoconus in an Iranian population.
      ,
      • Xiao W.
      • He J.
      • Fu W.
      • Xu Y.
      • Zhang Z.
      LOX gene polymorphisms are associated with osteoporotic vertebral compression fracture in postmenopausal Chinese women.
      ,

      Siddique PM, Malik RK, Chohan AA, et al. Analysis of VSX1, HGF and LOX in the Pakistani familial and sporadic Keratoconus patients. 2016:1-1.

      . The rs2956540 and rs10519694 are two well-known SNPs found in the fourth intron of the LOX gene and connected to KC in different populations
      • Xu X.
      • Zhang X.
      • Cui Y.
      • et al.
      Three novel variants identified within ECM-related genes in Chinese Han keratoconus patients.
      ,
      • Bykhovskaya Y.
      • Rabinowitz Y.S.
      Update on the genetics of keratoconus.
      ,
      • Zhang J.
      • Zhang L.
      • Hong J.
      • Wu D.
      • Xu J.
      Association of common variants in LOX with keratoconus: a meta-analysis.
      ,
      • Mok J.-W.
      • So H.-R.
      • Ha M.-J.
      • Na K.-S.
      • Joo C.-K.
      Association with Corneal Remodeling Related Genes, ALDH3A1, LOX, and SPARC Genes Variations in Korean Keratoconus Patients.
      .
      Alterations in LOX corneal tissue expression in KC patients have been demonstrated. One study showed LOX to be significantly downregulated in KC patients compared to controls
      • Karolak J.A.
      • Ginter-Matuszewska B.
      • Tomela K.
      • et al.
      Further evaluation of differential expression of keratoconus candidate genes in human corneas.
      . Dudakova et al. observed lower LOX activity in corneal fibroblast cultures from KC individuals
      • Dudakova L.
      • Liskova P.
      • Trojek T.
      • Palos M.
      • Kalasova S.
      • Jirsova K.
      Changes in lysyl oxidase (LOX) distribution and its decreased activity in keratoconus corneas.
      .
      In addition to a significant drop in LOX mRNA levels, Pahuja et al. showed a reduction in the ratio of LOX expression with increasing KC grades
      • Pahuja N.
      • Kumar N.R.
      • Shroff R.
      • et al.
      Differential molecular expression of extracellular matrix and inflammatory genes at the corneal cone apex drives focal weakening in keratoconus.
      . Collectively, the results of these studies suggest that alterations in LOX biological activity through changes in DNA sequences, particularly in non-coding intronic sequences, correlate with the risk of KC development.
      We looked at the relationship between two known intronic SNPs in the LOX gene, rs2956540 and rs10519694, and KC in a population of Iranian descent. A recent study identified rs2956540-G as a risk allele for KC in a population of Europeans
      • Dudakova L.
      • Palos M.
      • Jirsova K.
      • et al.
      Validation of rs2956540:G>C and rs3735520:G>A association with keratoconus in a population of European descent.
      . However, we found rs2956540-C allele highly prevalent in KC patients, whereas the G-allele was more common in the healthy population. Additionally, we noted no significant difference in rs10519694 allele frequency between cases and controls. Furthermore, we found that being a rs10519694-T carrier was more frequently and significantly observed among Iranian KC patients. While previous studies did not clearly define which rs10519694 allele is the risk allele, we found rs10519694-T to be a significant risk factor for KC. As in previous studies, we found no significant association between gender and rs2956540 and rs10519694 alleles in both KC subjects and healthy controls.
      In this study, we examined gene and allele frequencies in a referral center in a consecutive, non-random group of Iranian descent. Further studies on KC patients evaluating more SNPs with larger sample sizes in different populations are needed for definitive results.

      Conclusion

      We evaluated the association between two well-known LOX gene SNPs, rs2956540 and rs10519694, and KC in a population of Iranian descent for the first time. We found the rs10519694 variant is more prevalent in KC patients. Further studies should be conducted integrating other genetic information and questionnaires to assess environmental factors and characterize the severity of allergies and frequency of eye rubbing.

      References

        • Davidson A.
        • Hayes S.
        • Hardcastle A.
        • Tuft S.
        The pathogenesis of keratoconus.
        Eye. 2014; 28: 189-195
        • Gordon-Shaag A.
        • Millodot M.
        • Shneor E.
        • Liu Y.
        The genetic and environmental factors for keratoconus.
        BioMed research international. 2015; 2015
        • Buzard K.A.
        • Fundingsland B.R.
        Corneal transplant for keratoconus: Results in early and late disease.
        Journal of Cataract & Refractive Surgery. 1997/04/01/ 1997; 23: 398-406https://doi.org/10.1016/S0886-3350(97)80184-8
        • Özalp O.
        • Atalay E.
        • Yıldırım N.
        Prevalence and risk factors for keratoconus in a university-based population in Turkey.
        Journal of Cataract & Refractive Surgery. 2021; 47: 1524-1529
        • Netto E.A.T.
        • Al-Otaibi W.M.
        • Hafezi N.L.
        • et al.
        Prevalence of keratoconus in paediatric patients in Riyadh, Saudi Arabia.
        British Journal of Ophthalmology. 2018; 102: 1436-1441
        • Godefrooij D.A.
        • De Wit G.A.
        • Uiterwaal C.S.
        • Imhof S.M.
        • Wisse R.P.L.
        Age-specific incidence and prevalence of keratoconus: a nationwide registration study.
        American journal of ophthalmology. 2017; 175: 169-172
        • Omer K.
        Epidemiology of keratoconus worldwide.
        The Open Ophthalmology Journal. 2018; 12
        • Xu X.
        • Zhang X.
        • Cui Y.
        • et al.
        Three novel variants identified within ECM-related genes in Chinese Han keratoconus patients.
        Scientific reports. 2020; 10: 1-8
        • Hashemi H.
        • Heydarian S.
        • Hooshmand E.
        • et al.
        The Prevalence and Risk Factors for Keratoconus: A Systematic Review and Meta-Analysis.
        Cornea. 2020; 39
        • Khawaja A.P.
        • Rojas Lopez K.E.
        • Hardcastle A.J.
        • et al.
        Genetic Variants Associated With Corneal Biomechanical Properties and Potentially Conferring Susceptibility to Keratoconus in a Genome-Wide Association Study.
        JAMA Ophthalmology. 2019; 137: 1005-1012https://doi.org/10.1001/jamaophthalmol.2019.2058
        • Guerra G.
        • de Oliveira V.
        • Ferreira I.
        • Ramos I.
        • Belin M.
        • Ambrósio Jr., R.
        Subclinical keratoconus detection in identical twins.
        Int J Keratoconus Ectatic Corneal Dis. 2016; 5: 35-39
        • Bykhovskaya Y.
        • Rabinowitz Y.S.
        Update on the genetics of keratoconus.
        Experimental Eye Research. 2021/01/01/ 2021; 202108398https://doi.org/10.1016/j.exer.2020.108398
      1. Khaled ML, Helwa I, Drewry M, Seremwe M, Estes A, Liu Y. Molecular and Histopathological Changes Associated with Keratoconus. BioMed Research International. 2017/01/30 2017;2017:7803029. doi:10.1155/2017/7803029

        • Dudakova L.
        • Liskova P.
        • Trojek T.
        • Palos M.
        • Kalasova S.
        • Jirsova K.
        Changes in lysyl oxidase (LOX) distribution and its decreased activity in keratoconus corneas.
        Experimental eye research. 2012; 104: 74-81
        • Bykhovskaya Y.
        • Li X.
        • Epifantseva I.
        • et al.
        Variation in the lysyl oxidase (LOX) gene is associated with keratoconus in family-based and case-control studies.
        Investigative ophthalmology & visual science. 2012; 53: 4152-4157
        • Bykhovskaya Y.
        • Gromova A.
        • Makarenkova H.P.
        • Rabinowitz Y.S.
        Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus.
        International journal of keratoconus and ectatic corneal diseases. 2016; 5: 63
        • Collier S.A.
        Is the corneal degradation in keratoconus caused by matrix‐metalloproteinases?.
        Clinical & experimental ophthalmology. 2001; 29: 340-344
        • Rabinowitz Y.S.
        • Dong L.
        • Wistow G.
        Gene expression profile studies of human keratoconus cornea for NEIBank: a novel cornea-expressed gene and the absence of transcripts for aquaporin 5.
        Investigative ophthalmology & visual science. 2005; 46: 1239-1246
        • Tai T.Y.T.
        • Damani M.R.
        • Vo R.
        • et al.
        Keratoconus associated with corneal stromal amyloid deposition containing TGFBIp.
        Cornea. 2009; 28: 589
        • Macé M.
        • Galiacy S.D.
        • Erraud A.
        • et al.
        Comparative transcriptome and network biology analyses demonstrate antiproliferative and hyperapoptotic phenotypes in human keratoconus corneas.
        Investigative ophthalmology & visual science. 2011; 52: 6181-6191
        • Hasanian-Langroudi F.
        • Saravani R.
        • Validad M.-H.
        • Bahari G.
        • Yari D.
        Association of Lysyl oxidase (LOX) polymorphisms with the risk of Keratoconus in an Iranian population.
        Ophthalmic genetics. 2015; 36: 309-314
        • Shetty R.
        • Sathyanarayanamoorthy A.
        • Ramachandra R.A.
        • et al.
        Attenuation of lysyl oxidase and collagen gene expression in keratoconus patient corneal epithelium corresponds to disease severity.
        Molecular vision. 2015; 21: 12
        • Bykhovskaya Y.
        • Margines B.
        • Rabinowitz Y.S.
        Genetics in Keratoconus: where are we?.
        Eye and Vision. 2016; 3: 1-10
        • Li X.
        • Rabinowitz Y.S.
        • Tang Y.G.
        • et al.
        Two-stage genome-wide linkage scan in keratoconus sib pair families.
        Investigative ophthalmology & visual science. 2006; 47: 3791-3795
        • Liskova P.
        • Dudakova L.
        • Krepelova A.
        • Klema J.
        • Hysi P.G.
        Replication of SNP associations with keratoconus in a Czech cohort.
        PLoS One. 2017; 12e0172365
        • Ates K.M.
        • Estes A.J.
        • Liu Y.
        Potential underlying genetic associations between keratoconus and diabetes mellitus.
        Advances in Ophthalmology Practice and Research. 2021/11/01/ 2021; 1100005https://doi.org/10.1016/j.aopr.2021.100005
        • Abu-Amero K.K.
        • Helwa I.
        • Al-Muammar A.
        • et al.
        Case-control association between CCT-associated variants and keratoconus in a Saudi Arabian population.
        Journal of Negative Results in BioMedicine. 2015/06/04 2015; 14: 10https://doi.org/10.1186/s12952-015-0029-5
        • Dudakova L.
        • Palos M.
        • Jirsova K.
        • et al.
        Validation of rs2956540:G>C and rs3735520:G>A association with keratoconus in a population of European descent.
        European journal of human genetics : EJHG. Nov. 2015; 23: 1581-1583https://doi.org/10.1038/ejhg.2015.28
        • Zhang J.
        • Zhang L.
        • Hong J.
        • Wu D.
        • Xu J.
        Association of common variants in LOX with keratoconus: a meta-analysis.
        PloS one. 2015; 10e0145815
        • Rabinowitz Y.S.
        Keratoconus. Survey of Ophthalmology. 1998; 42: 297-319https://doi.org/10.1016/S0039-6257(97)00119-7
        • Matalia H.
        • Swarup R.
        Imaging modalities in keratoconus.
        Indian Journal of Ophthalmology. 2013; 61
        • Kriszt Á.
        • Losonczy G.
        • Berta A.
        • Takács L.
        Presence of Fleischer ring and prominent corneal nerves in keratoconus relatives and normal controls.
        Int J Ophthalmol. 2015; 8: 922-927https://doi.org/10.3980/j.issn.2222-3959.2015.05.12
        • Ambrósio R.
        • Lopes B.T.
        • Faria-Correia F.
        • et al.
        Integration of Scheimpflug-Based Corneal Tomography and Biomechanical Assessments for Enhancing Ectasia Detection.
        Journal of Refractive Surgery. 2017; 33: 434-443https://doi.org/10.3928/1081597X-20170426-02
      2. Mohammadpour M. Diagnostics in Ocular Imaging: Cornea, Retina, Glaucoma and Orbit. Springer Nature; 2020.

        • Augustin V.A.
        • Son H.-S.
        • Baur I.
        • Zhao L.
        • Auffarth G.U.
        • Khoramnia R.
        Detecting subclinical keratoconus by biomechanical analysis in tomographically regular keratoconus fellow eyes.
        European Journal of Ophthalmology. 2022; 32: 815-822https://doi.org/10.1177/11206721211063740
        • Kataria P.
        • Padmanabhan P.
        • Gopalakrishnan A.
        • Padmanaban V.
        • Mahadik S.
        • Ambrósio R.
        Accuracy of Scheimpflug-derived corneal biomechanical and tomographic indices for detecting subclinical and mild keratectasia in a South Asian population.
        Journal of Cataract & Refractive Surgery. 2019/03/01/ 2019; 45: 328-336https://doi.org/10.1016/j.jcrs.2018.10.030
        • Chacon Cortes D.F.
        • Griffiths L.
        Methods for extracting genomic DNA from whole blood samples: current perspectives.
        Journal of Biorepository Science for Applied Medicine. 2014; 2014: 1-9
        • Karimian F.
        • Aramesh S.
        • Rabei H.M.
        • Javadi M.A.
        • Rafati N.
        Topographic evaluation of relatives of patients with keratoconus.
        Cornea. 2008; 27: 874-878
        • Kaya V.
        • Utine C.A.
        • Altunsoy M.
        • Oral D.
        • Yilmaz O.F.
        Evaluation of corneal topography with Orbscan II in first-degree relatives of patients with keratoconus.
        Cornea. 2008; 27: 531-534
        • Zadnik K.
        • Barr J.T.
        • Edrington T.B.
        • et al.
        Baseline findings in the Collaborative Longitudinal Evaluation of Keratoconus (CLEK) Study.
        Investigative ophthalmology & visual science. 1998; 39: 2537-2546
        • Bechara S.J.
        • Waring 3rd, G.
        • Insler M.S.
        Keratoconus in two pairs of identical twins.
        Cornea. 1996; 15: 90-93
        • Cullen J.
        • Butler H.
        Mongolism (Down's syndrome) and keratoconus.
        The British journal of ophthalmology. 1963; 47: 321
      3. Elder MJ. Leber congenital amaurosis and its association with keratoconus and keratoglobus. SLACK Incorporated Thorofare, NJ; 1994. p. 38-40.

        • Hardcastle A.J.
        • Liskova P.
        • Bykhovskaya Y.
        • et al.
        A multi-ethnic genome-wide association study implicates collagen matrix integrity and cell differentiation pathways in keratoconus.
        Communications biology. 2021; 4: 1-13
        • Georgiou T.
        • Funnell C.
        • Cassels-Brown A.
        • O'conor R.
        Influence of ethnic origin on the incidence of keratoconus and associated atopic disease in Asians and white patients.
        Eye. 2004; 18: 379-383
        • Rong S.S.
        • Ma S.T.U.
        • Yu X.T.
        • et al.
        Genetic associations for keratoconus: a systematic review and meta-analysis.
        Scientific reports. 2017; 7: 1-11
        • Wang Y.
        • Rabinowitz Y.
        • Rotter J.
        • Yang H.
        Genetic epidemiological study of keratoconus: evidence for major gene determination.
        American journal of medical genetics. 2000; 93: 403-409
      4. Kalra N, Sinha R. Genetics of Keratoconus. In: Nema HV, Nema N, eds. Genetics of Ocular Diseases. Springer Nature Singapore; 2022:15-23.

        • Hutchings H.
        • Ginisty H.
        • Le Gallo M.
        • et al.
        Identification of a new locus for isolated familial keratoconus at 2p24.
        Journal of Medical Genetics. 2005; 42: 88https://doi.org/10.1136/jmg.2004.022103
        • Cai L.
        • Xiong X.
        • Kong X.
        • Xie J.
        The Role of the Lysyl Oxidases in Tissue Repair and Remodeling: A Concise Review.
        Tissue Eng Regen Med. Feb. 2017; 14: 15-30https://doi.org/10.1007/s13770-016-0007-0
        • Gadelha D.N.B.
        • Feitosa A.F.B.
        • da Silva R.G.
        • et al.
        Screening for novel LOX and SOD1 variants in keratoconus patients from Brazil.
        Journal of ophthalmic & vision research. 2020; 15: 138
        • Xiao W.
        • He J.
        • Fu W.
        • Xu Y.
        • Zhang Z.
        LOX gene polymorphisms are associated with osteoporotic vertebral compression fracture in postmenopausal Chinese women.
        Gene. 2020/05/30/ 2020; 741144543https://doi.org/10.1016/j.gene.2020.144543
      5. Siddique PM, Malik RK, Chohan AA, et al. Analysis of VSX1, HGF and LOX in the Pakistani familial and sporadic Keratoconus patients. 2016:1-1.

        • Mok J.-W.
        • So H.-R.
        • Ha M.-J.
        • Na K.-S.
        • Joo C.-K.
        Association with Corneal Remodeling Related Genes, ALDH3A1, LOX, and SPARC Genes Variations in Korean Keratoconus Patients.
        Korean journal of ophthalmology: KJO. 2021; 35: 120
        • Karolak J.A.
        • Ginter-Matuszewska B.
        • Tomela K.
        • et al.
        Further evaluation of differential expression of keratoconus candidate genes in human corneas.
        PeerJ. 2020; 8e9793
        • Pahuja N.
        • Kumar N.R.
        • Shroff R.
        • et al.
        Differential molecular expression of extracellular matrix and inflammatory genes at the corneal cone apex drives focal weakening in keratoconus.
        Investigative ophthalmology & visual science. 2016; 57: 5372-5382